Happy RNA Day!

Wishing you the best start to the next year!

Here is our wish for you, hope it doesn’t get lost in translation:

AUGGCGUAUUAUGAACGCCGCAACGCGAGCACCGCGUAUAUUAACACCGCGUGCACCUAA !!!